Skip to main content

Table 1 Primer sequences

From: Identification of body fluids—menstrual blood, saliva, and nasal secretions—over different periods of time, using mRNA

Body fluid Gene Primer (F and R) Size (bp) Reference
Nasal BPIFA1 F:CAAGTGAATACGCCCCTGGTCG 131 van den Berge et al. 2016
R:GAATGGGTGCAGTCACCAAGGAC
STATH F:TTTGCCTTCATCTTGGCTCT] 93 Lindenbergh et al. 2012
SalivaSaliva R:CCCATAACCGAATCTTCCAA
HTN3 F:ATGGGCCAGCACACAGAC. 134
R:GCAAAGAGACATCATGGGTA
Menstrual Blood MMP-7 F:TTTTCCCATGGGGAAATATAGGT 127
R:GAACAGGCTCAGGACTATCTC
MMP-10 F:GCATCTTGCATTCCTTGTGCTGTTG 107 van den Berge et al. 2016
R:GGTATTGCTGGGCAAGATCCTTGTT
Housekeeping Gene B-actin (ACTB) F:CTTGGGAGGGCACTTGGGGGTG   Lindenbergh et al. 2012
R:TGACCCAGATCATGTTTGAG
  1. A Adenine, C Cytosine, G Guanine, T Thymine, B-actin Beta-actin, STATH Statherin, HTN3 Histatin 3, BPIFA1 Lipid-binding protein that plays a role in the innate immune responses of the upper airway, MMP10 Metalloproteinase 10, MMP7 Metalloproteinase 7