Skip to main content

Table 1 Details of primers used for individual body fluid DNA methylation markers

From: Application of DNA methylation-based markers in identification of mixed body fluid evidences simulating crime scene scenarios

Marker Primer Sequence (5′–3′)
Cg09696411 (menstrual blood) MENS1-F GATTAGGTTTAGGGAAGTTTTTAT
MENS1-R ACC CTC TAA AAC TTA TAC TCC C
Cg13763232 (peripheral blood) BLM1-F TAGTTGATATTGGTTTGGTA
BlM1-R CAAATAACTCAATTTCTCTAC
Cg05656364 (semen) Sperm2-F ACT AAA ATC TAA ACT AAA AAC TAC CC
Sperm2-R ATA GTT TTG AGT TGT TTT GGT AGG TG
Cg11768416 (semen) SEU2-F GGAGGTTGTTTTTTTTTTGGTTT
SEU2-R CTACCAACACCTTCCTCC