Skip to main content

Table 2 Nucleotide sequence of the primers used for library preparation

From: DNA metabarcoding of forensic mycological samples

Primer Sequence (from 5′ to 3′)
ITS1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTTGGTCATTTAGAGGAAGTAA
ITS2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCGTTCTTCATCGATGC
ITS3 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCATCGATGAAGAACGCAGC
ITS4 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC