Skip to main content

Table 1 Primer sequences of the studied genes

From: Therapeutic effects of N-acetylcysteine against malathion-induced hepatotoxicity

Gene Primer sequence
Bax Forward primer: CCCTGTGCACTAAAGTGCCC
Reverse primer: CTTCTTCACGATGGTGAGCG
Bcl-2 Forward primer: CTACGAGTGGGATGCTGGAG
Reverse primer: GGTCAGATGGACACATGGTG
IL-1β Forward primer :CATCTTTGAAGAAGAGCCCG
Reverse primer: AACTATGTCCCGACCATTGC
IL-6 Forward primer: CCGGAGAGGAGACTTCACAG
Reverse primer: GAGCATTGGAGGTTGGGGTA
IFN-γ Forward primer: AGGAAAGAGCCTCCTCTTGG
Reverse primer: TCTACCCCAGAATCAGCACC
Beta actin Forward primer: GACGGCCAGGTCATCACTAT
Reverse primer: CTTCTGCATCCTGTCAGCAA