Skip to main content

Table 1 Primer sequences specific for each gene

From: XIST and RPS4Y1 long non-coding RNA transcriptome as sex biomarkers in different body fluids

Gene Primer sequence: 5′–3′ GenBank accession number
XIST (long non-coding RNA) F: ATTTTAACTGATCCCATTGAAGATACCACGC
R: TCAGAATGTCCAAGAGGAGCCTAAGG
NR_001564.2
RPS4Y1 ribosomal protein S4, Y-linked 1 F: TGGAAGAGGCAAAGTACAAGTTGTGC
R: GGATTCCCTTCACTCCCACAGTAAT
NM_001008.3
β-actin F: GGCGGCACCACCATGTACCCT
R: AGGGGCCGGACTCGTCATACT
NM_001101.3