Skip to main content

Table 1 Primer sequences used for the amplification and sequencing of mtDNA control region

From: Allele frequencies of mitochondrial DNA HVR III 514–524 (CA)n dinucleotide repeats in the Urali Kuruman tribal population of South India

Sl. no Primer 5′–3′ sequence structure (Rieder et al. 1998)
1 23F TCATTGGACAAGTAGCATCC
2 23R GAGTGGTTAATAGGGTGATAG
3 24F CACCATTCTCCGTGAAATCA
4 24R AGGCTAAGCGTTTTGAGCTG