Skip to main content

Table 1 AR, SRY and DYS14-specific primers sets and base sequences. (Mohammed & Tayel, 2005; Gomaa & Sheta, 2013)

From: Sex determination from dental pulp DNA among Egyptians

Primer Sequence 5′-3′
AR Forward CTCTGGGCTTATTGTAAACTTCC
AR Reverse GTCCAGGAGCTGGCTTTTCCCTA
SRY forward GGTGTTGAGGGCGGAGAAATGC
SRY Reverse GTAGCCAATGTTACCCGATTGTC
DYS14 Forward CATCCAGAGCGTCCCTGG
DYS14 Reverse TTCCCCTTTGTTCCCCAAA